90
|
ATCC
tib 84 Tib 84, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tib 84/product/ATCC Average 90 stars, based on 1 article reviews
tib 84 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
ATCC
anti mac3 antibody Anti Mac3 Antibody, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti mac3 antibody/product/ATCC Average 90 stars, based on 1 article reviews
anti mac3 antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
91
|
ATCC
pseudomonas japonica jmc 21532t Pseudomonas Japonica Jmc 21532t, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pseudomonas japonica jmc 21532t/product/ATCC Average 91 stars, based on 1 article reviews
pseudomonas japonica jmc 21532t - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
90
|
ATCC
enterococcus italicus tp1 5t aj582753 enterococcus alcedinis l34t enterococcus alcedinis l34t jx948102 enterococcus aquimarinus lmg 16607t Enterococcus Italicus Tp1 5t Aj582753 Enterococcus Alcedinis L34t Enterococcus Alcedinis L34t Jx948102 Enterococcus Aquimarinus Lmg 16607t, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/enterococcus italicus tp1 5t aj582753 enterococcus alcedinis l34t enterococcus alcedinis l34t jx948102 enterococcus aquimarinus lmg 16607t/product/ATCC Average 90 stars, based on 1 article reviews
enterococcus italicus tp1 5t aj582753 enterococcus alcedinis l34t enterococcus alcedinis l34t jx948102 enterococcus aquimarinus lmg 16607t - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
ATCC
35048t 96 vpaciniilmg 19999t v cholerae atcc 14035t v aerogenesatcc 700797t v fischeri atcc 7744t shewanellu oneidensis mr l 35048t 96 Vpaciniilmg 19999t V Cholerae Atcc 14035t V Aerogenesatcc 700797t V Fischeri Atcc 7744t Shewanellu Oneidensis Mr L, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/35048t 96 vpaciniilmg 19999t v cholerae atcc 14035t v aerogenesatcc 700797t v fischeri atcc 7744t shewanellu oneidensis mr l/product/ATCC Average 90 stars, based on 1 article reviews
35048t 96 vpaciniilmg 19999t v cholerae atcc 14035t v aerogenesatcc 700797t v fischeri atcc 7744t shewanellu oneidensis mr l - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
synthesized 84 mer oligonucleotide with a mw of 26667.3 consisted of ttaggg repeats 14 times  Synthesized 84 Mer Oligonucleotide With A Mw Of 26667.3 Consisted Of Ttaggg Repeats 14 Times, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthesized 84 mer oligonucleotide with a mw of 26667.3 consisted of ttaggg repeats 14 times/product/TIB MOLBIOL Average 90 stars, based on 1 article reviews
synthesized 84 mer oligonucleotide with a mw of 26667.3 consisted of ttaggg repeats 14 times - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
ATCC
hopb13 gaatgatggaaagagggcaa aggacttccctgagaccctc Hopb13 Gaatgatggaaagagggcaa Aggacttccctgagaccctc, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hopb13 gaatgatggaaagagggcaa aggacttccctgagaccctc/product/ATCC Average 90 stars, based on 1 article reviews
hopb13 gaatgatggaaagagggcaa aggacttccctgagaccctc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
94
|
ATCC
s vinaceus atcc 27476t S Vinaceus Atcc 27476t, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/s vinaceus atcc 27476t/product/ATCC Average 94 stars, based on 1 article reviews
s vinaceus atcc 27476t - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
oligonucleotide 3 lambda564!84!43 (sense and biotin-labeled antisense) Oligonucleotide 3 Lambda564!84!43 (Sense And Biotin Labeled Antisense), supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligonucleotide 3 lambda564!84!43 (sense and biotin-labeled antisense)/product/TIB MOLBIOL Average 90 stars, based on 1 article reviews
oligonucleotide 3 lambda564!84!43 (sense and biotin-labeled antisense) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Asian Pacific Journal of Cancer Prevention : APJCP
Article Title: Chromosome Abnormalities and Absolute Telomere Lengths of Leukocytes from Silk Weavers with Emphasis on Potential Genotoxicity and Mutagenicity of Silk Dyes
doi: 10.22034/APJCP.2018.19.2.541
Figure Lengend Snippet: Standard Curve of SYBR Green qRT-PCR, Generated by LightCycler® 480 Real Time PCR System (Roche Diagnostics GmbH, Mannheim, Germany), for Telomere Length Determination Using Known Quantities of Synthesized 84 Mer Oligonucleotide with a MW of 26667.3 Consisted of TTAGGG Repeats 14 Times (TIB MOLBIOL, Syntheselabor GmbH, Germany).
Article Snippet: The standard curve was established using serial dilution of known quantities of synthesized 84
Techniques: SYBR Green Assay, Quantitative RT-PCR, Generated, Real-time Polymerase Chain Reaction, Synthesized